ktrD [2019-04-16 14:29:50]

low affinity potassium channel KtrC-KtrD, integral membrane subunit

Locus: BSU13500

Isoelectric point: 9.22

Molecular weight: 49.26 kDa

Protein length: 449 aa

Gene length: 1350 bp

Function: potassium uptake

Product: low affinity potassium channel KtrC-KtrD, integral membrane subunit

Essential: no

Synonyms: ykrM

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Metal ion transporter
• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Potassium uptake/ export
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,416,067 1,417,416

The protein

Catalyzed reaction/ biological activity

• uptake of potassium

Paralogous protein(s)

• KtrB

Kinetic information

• the KtrC-KtrD channel has a low affinity for potassium,this is determined by KtrD PubMed

Structure

• 4J7C (the KtrA-KtrB complex, 36% identity) PubMed

Localization

• integral membrane protein PubMed

Expression and Regulation

Operons

• Genes: ktrD
  Description: PubMed

  Regulation

  • constitutively expressed

Biological materials

Mutant

• MGNA-B317 (ykrM::erm), available at the NBRP B. subtilis, Japan
• GHB12 (ktrD::tet), PubMed, available in Erhard Bremer's and Jörg Stülke's labs
• GP2030 (ktrD::tet), available in Jörg Stülke's lab PubMed
• 1A956 (ktrD::tet), PubMed, available at BGSC
• BKE13500 (ktrD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT, downstream forward: _UP4_TAGGCAAAACACCGCATATT
• BKK13500 (ktrD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT, downstream forward: _UP4_TAGGCAAAACACCGCATATT

FLAG-tag construct

• GP2434 ktrD-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany homepage

References

Reviews

Loading

Original publications

Loading