bdbC

thiol-disulfide oxidoreductase, required for the formation of thiol disulfide bonds in several proteins

Locus: BSU_33470

Isoelectric point: 9.05

Molecular weight: 15.57 kDa

Protein length: 138 aa

Gene length: 417 bp

Function: oxidative folding of proteins

Product: thiol-disulfide oxidoreductase

Essential: no

Synonyms: yvgU

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → Genetic competence
• Information processing → Protein synthesis, modification and degradation → Chaperones/ protein folding
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,437,644 3,438,060

Phenotypes of a mutant

• loss of transformability PubMed
• sensitive to osmotic shock PubMed
• several proteins are absent from the membrane proteome of a bdbC-bdbD mutant: PubMed
• the membrane proteins BglP, TcyP, SipU, LytA, and YxaI PubMed
• the cytoplasmic or membrane-associated proteins GlkX, ProA, PyrAA, PyrAB, PyrH, PyrE, PyrF, DegS, YbxA PubMed

The protein

Catalyzed reaction/ biological activity

• formation of thiol disulfide bonds in ComEC and ComGC (together with BdbD) PubMed
• oxidative folding of SunA (together with BdbB)

Protein family

• DsbB family (with BdbB, according to UniProt)

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: bdbD-bdbC
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulatory mechanism

  • ComK: activation, PubMed, in ComK regulon

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed

Biological materials

Mutant

• MGNA-B603 (yvgU::erm), available at the NBRP B. subtilis, Japan
• BKE33470 (bdbC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTGTTACTTCCCTTTC, downstream forward: _UP4_TAACAAAAAAAGCGCCCGCG
• BKK33470 (bdbC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTGTTACTTCCCTTTC, downstream forward: _UP4_TAACAAAAAAAGCGCCCGCG

References

Reviews

Loading

Original publications

Loading