gdpP [2020-04-01 14:44:06]

c-di-AMP specific phosphodiesterase

locus: BSU_40510

pI: 4.86

mw: 74.14 kDa

protein length: 659 aa

gene length: 1980 bp

function: control of sporulation initiation, cell wall homeostasis

product: c-di-AMP phosphodiesterase

essential: no

synonyms: yybT

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
• [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 4,163,643 4,165,622

Phenotypes of a mutant

• inactivation of ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
• a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
• a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [SW|biofilm formation] [Pubmed|27252699]
• altered morphology on MSgg medium [pubmed|29588402]

The protein

Catalyzed reaction/ biological activity

• cyclic dinucleotide phosphodiesterase, hydrolysis of cyclic di-AMP [Pubmed|19901023]
• 3',3'-c-di-AMP + H₂O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H⁺ (according to UniProt)

Protein family

• GdpP/PdeA phosphodiesterase family (single member, according to UniProt)

[SW|Domains]

• two transmembrane domains at the N-terminus [Pubmed|19901023]
• a domain that shares minimum sequence homology with Heme-binding [PAS domain|Per-ARNT-Sim (PAS) domains] (80 aa) [Pubmed|21257773]
• degenerate [SW|GGDEF domain] (aa 173 - 301) [Pubmed|19901023]
• a [SW|DHH-DHHA1 domain] [Pubmed|19901023]

Effectors of protein activity

• ppGpp inhibits cyclic dinucleotide phosphodiesterase activity [Pubmed|19901023]
• Heme binding suppresses phosphodiesterase activity [Pubmed|21257773]

Structure

• [PDB|2M1C] (N-terminal PAS domain of GdpP from ''Geobacillus thermodenitrificans'') [Pubmed|23504327]

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
  description: [Pubmed|22383849]

  additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]

Biological materials

Mutant

• MGNA-B834 (yybT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1833 NBRP B. subtilis, Japan]
• GP998 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc''), available in [SW|Jörg Stülke]'s lab [Pubmed|23192352]
• GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
• BKE40510 ([gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
• BKK40510 ([gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA

References

Reviews

• 25869574,26773214,30224435

Original publications

• 19901023,21257773,21566650,23504327,22211522,22956758,25616256,26240071,27252699,29588402

GdpP homologs in other organisms

• 18502872