mhqR [2017-12-05 17:30:30]

MarR-family transcriptional repressor of azoR2, mhqA, mhqD-mhqE and mhqN-mhqO-mhqP expression

locus: BSU13670

pI: 6.42

mw: 16.43 kDa

protein length: 145 aa

gene length: 435 bp

function: regulation of resistance to quinones and diamide

product: MarR-family transcriptional repressor

essential: no

synonyms: ykvE

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]

Gene

Coordinates: 1,433,199 → 1,433,636

Phenotypes of a mutant

• resistant to quinones and diamide
• inactivation of ''mhqR'' predisposes cells to grow without a wall (due to protection from oxidative stress) [Pubmed|26051891]

The protein

Additional information

• '''Binding site:''' tATCTcgaAtTCgAGATaaaa [Pubmed|17725564]

Expression and Regulation

Operons

• genes: [gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]
  description: [Pubmed|22383849]

Biological materials

Mutant

• BKE13670 (Δ[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
• BKK13670 (Δ[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA

Labs working on this gene/protein

• [SW|Haike Antelmann],Free University of Berlin, Germany

References

• 18282125,26051891,17725564,22383849,27965289