mhqR

MarR family transcriptional repressor of azoR2, mhqA, mhqD-mhqEand mhqN-mhqO-mhqP expression

Locus: BSU_13670

Isoelectric point: 6.42

Molecular weight: 16.43 kDa

Protein length: 145 aa

Gene length: 438 bp

Function: regulation of resistance to quinones and diamide

Product: MarR family transcriptional repressor

Essential: no

Synonyms: ykvE

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 1,433,199 1,433,636

Phenotypes of a mutant

• resistant to quinones and diamide
• inactivation of mhqR predisposes cells to grow without a wall (due to protection from oxidative stress) PubMed

The protein

Paralogous protein(s)

• YkoM

Domains

• HTH marR-type domain (aa 5-137) (according to UniProt)

Structure

• 3GFJ (from Sulfolobus tokodaii, 26% identity) PubMed

Additional information

• Binding site: tATCTcgaAtTCgAGATaaaa PubMed
• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: mhqR
  Description: PubMed

Biological materials

Mutant

• BKE13670 (mhqR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
• BKK13670 (mhqR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA

Labs working on this gene/protein

• Haike Antelmann,Free University of Berlin, Germany

References

Loading