flhA

part of the flagellar type III export apparatus (flagellar Type III secretion system), part of the CORE complex required for flagellum and nanotube assembly

Locus: BSU_16390

Isoelectric point: 4.64

Molecular weight: 73.77 kDa

Protein length: 677 aa

Gene length: 2034 bp

Function: flagellum and nanotube assembly

Product: part of the type III CORE export apparatus

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein secretion
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Flagellar proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,707,714 1,709,747

Phenotypes of a mutant

• no secretion of FlgM, permanent inhibition of SigD PubMed
• inactivation of flhA confers resistance to high concentrations of Zn(II) PubMed
• deficient in both nanotube production and the associated intercellular molecular trafficking PubMed

The protein

Protein family

• FHIPEP (flagella/HR/invasion proteins export pore) family (single member, according to UniProt)

Structure

• 3MIX (cytosolic domain) PubMed

Localization

• cell membrane PubMed, 8 transmembrane helices PubMed

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • CodY: repression, in CodY regulon
  • DegU: regulation, in DegU regulon
  • SwrA: activation, in SwrA regulon

  Regulation

  • see fla-che operon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • SwrA: activation, in SwrA regulon
  • CodY: repression, in CodY regulon
  • DegU: repression, in DegU regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Biological materials

Mutant

• BKE16390 (flhA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTGTTTTTTCTCTCCT, downstream forward: _UP4_AGCATTGGAGTGGTGGATAT
• BKK16390 (flhA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCTGTTTTTTCTCTCCT, downstream forward: _UP4_AGCATTGGAGTGGTGGATAT

References

Reviews

Loading

Original publications

Loading