You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yoqW [2018-11-01 16:08:41]
similar to general secretion pathway protein
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.6|Protein secretion/ based on similarity][category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]The protein
Protein family
XPT subfamily (according to Swiss-Prot)Biological materials
Mutant
BKE20490 (Δ[gene|9459834886B4943D514137F0E51536C771154183|yoqW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG, downstream forward: _UP4_TAAGTACCACTGCCATATCGBKK20490 (Δ[gene|9459834886B4943D514137F0E51536C771154183|yoqW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG, downstream forward: _UP4_TAAGTACCACTGCCATATCG