slrR [2018-02-13T15:16:49.000Z]

transcriptional activator (Xre family) of competence development and sporulation genes, represses SigD-dependent flagellar genes, antagonist of SlrA and SinR, has LexA-like autocleavage activity

Locus: BSU34380

Isoelectric point: 9.63

Molecular weight: 17.43 kDa

Protein length: 152 aa

Gene length: 456 bp

Function: regulation of initiation of biofilm formation and of autolysis

Product: transcriptional regulator (Xre family), SlrA antagonist

Essential: no

Synonyms: yveJ,slr

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Information processing → Regulation of gene expression → Transition state regulators
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming

Gene

Coordinates: 3,530,101 → 3,530,559

Phenotypes of a mutant

• smooth colonies on MsGG medium, no biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• SlrR binds to and inhibits the activity of SlrA, SlrA indirectly stimulates the synthesis of SlrR by interacting with SinR. SlrR can bind to SinR and SinR directly represses the transcription of SlrR. SlrR indirectly derepresses its own gene. The heterocomplex of SlrR-SinR is a repressor of autolysin and motility genes and inhibits the repressor function of SinR. PubMed
• repression of transcription of lytA-lytB-lytC and lytF PubMed
• autocleavage PubMed

Protein family

• Xre family

Paralogous protein(s)

• SinR

Modification

• subject to self-cleavage via a LexA-like autopeptidase, this involves ClpC and requires DegU PubMed

Effectors of protein activity

• interaction with SinR triggers binding of SlrR to the promoters of lytA-lytB-lytC and lytF, resulting in their repression PubMed

Expression and Regulation

Operons

• Genes: slrR-pnbA
  Description: PubMed

  Regulatory mechanism

  • Abh: activation, PubMed, in Abh regulon
  • SinR: repression, PubMed, in SinR regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Additional information

  • induction by sequestration of SinR by SinI, SlrA PubMed or by SlrR itself PubMed

Biological materials

Mutant

• MGNA-A089 (slr::erm), available at the NBRP B. subtilis, Japan
• GP955 (slrR-pnbA::cat), available in Jörg Stülke's lab
• BKE34380 (ΔslrR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT
• BKK34380 (ΔslrR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT

Expression vector

• pGP2905: expression in E. coli, with N-terminal His-tag, in pWH844, available in Jörg Stülke' lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke' lab

References

Reviews

Loading

Original publications

Loading