ywlF

ribose-5-phosphate isomerase

Locus: BSU_36920

Isoelectric point: 5.42

Molecular weight: 16.07 kDa

Protein length: 149 aa

Gene length: 450 bp

Function: pentose phosphate pathway

Product: ribose-5-phosphate isomerase

Essential: no

E.C.: 5.3.1.-

Synonyms: ipc-32d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Pentose phosphate pathway
• Information processing → Genetics → Newly identified competence genes

Gene

Coordinates: 3,791,199 3,791,648

Phenotypes of a mutant

• poor growth PubMed
• poorly transformable PubMed

The protein

Protein family

• LacAB/RpiB family (single member, according to UniProt)

Kinetic information

• Reversible Mass Action Kinetics PubMed PubMed

Effectors of protein activity

• Inhibited by 6-phosphogluconate and AMP PubMed
• Inhibited by divalent ions such as Ag2+, Mg2+, Co2+ and Zn2+ PubMed
• Activated by EDTA and 2-mercaptoethanol PubMed

Structure

• 3HEE (from Clostridium thermocellum, 55% identity, 72% similarity) PubMed

Additional information

• The enzyme has probably more than one active site, but with no cooperativity described PubMed

Expression and Regulation

Operons

• Genes: ywlF-ywlG
  Description: PubMed

  Regulatory mechanism

  • TnrA: repression, PubMed, in TnrA regulon

  Regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed

• Genes: ywlD-ywlE-ywlF-ywlG
  Description: PubMed

• Genes: ywlE-ywlF-ywlG
  Description: PubMed

Biological materials

Mutant

• BKE36920 (ywlF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGCTTTTCCTCCCAGC, downstream forward: _UP4_AAAAACCTGTAGGGGTGCTG
• BKK36920 (ywlF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGCTTTTCCTCCCAGC, downstream forward: _UP4_AAAAACCTGTAGGGGTGCTG

FLAG-tag construct

• GP1404 (spc, based on pGP1331), available in Jörg Stülke's lab

Antibody

• **

References

Loading