You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
hypR [2018-02-13T15:40:12.000Z]
MarR/DUF24 family transcription regulator, positively controls the nitroreductase gene hypO in response to disulfide stress
Molecular weight
14.59 kDa
Function
control of the nitroreductase gene hypO in response to disulfide stress (diamide, NaOCl)
Product
MarR/DUF24 family transcription regulator HypR
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
4,167,622 → 4,167,999
The protein
Protein family
Paralogous protein(s)
Kinetic information
Cys14 redox sensing Cys, has lower pKa of 6.36 PubMed Domains
5 alpha helices, 2 beta sheets, MarR-fold with wHTH motif, alpha4 major groove recognition helix, beta2 and 3 form the wing; alpha5 dimer interface PubMed Modification
oxidized to Cys14-Cys49' intersubunit disulfides by disulfide stress PubMedCys14 and Cys49' are about 8-9 Angström apart in reduced HypR-Dimer, oxidation moves the major groove recognition alpha4 helices of the HypR dimer about 4 Angstroem towards each other that leads to activation of HypR PubMed Structure
4A5N (reduced HypRC14S dimer) PubMed4A5M (oxidized HypR C14-C49' intersubunit disulfide-linked dimer ) PubMed Localization
cytoplasmicExpression and Regulation
Operons
Regulatory mechanism
Regulation
activated by disulfide stress conditions (diamide, NaOCl) in vivo and in vitro (autoregulation) PubMed view in new tabBiological materials
Mutant
MGNA-B836 (yybR::erm), available at the NBRP B. subtilis, JapanBKE40540 (ΔhypR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCTBKK40540 (ΔhypR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT Labs working on this gene/protein