You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ykuL [2018-08-17 19:19:21]
Molecular weight
16.49 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,485,453 → 1,485,896
The protein
Expression and Regulation
Biological materials
Mutant
MGNA-A773 (ykuL::erm), available at the NBRP B. subtilis, JapanBKE14130 (ykuL::erm trpC2) available in the Bacillus Genetic Stock Center and in Jörg Stülke's lab PubMedGP214 (deletion of ykuJ-ykuK-abbA-darB, replaced by aphA3), available in the Stülke labBKE14130 (ΔdarB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTTBKK14130 (ΔdarB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTT Expression vector
pGP2929 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's labpGP635: expression of Strep-ykuL by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's labpGP767: expression of ykuL-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's labpGP1550: expression of ykuL by pBQ200 in B. subtilis, available in Jörg Stülke's lab FLAG-tag construct
References
Loading