You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
darB [2020-04-01 14:45:40]
Molecular weight
16.49 kDa
Product
c-di-AMP binding protein
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,485,453 1,485,896
The protein
Domains
Effectors of protein activity
Structure
Expression and Regulation
Biological materials
Mutant
MGNA-A773 (ykuL::erm), available at the NBRP B. subtilis, JapanGP2769 (ΔdarB::ermC), available in Jörg Stülke's labBKE14130 (ykuL::erm trpC2) available in the Bacillus Genetic Stock Center and in Jörg Stülke's lab PubMedGP214 (deletion of ykuJ-ykuK-abbA-darB, replaced by aphA3), available in Jörg Stülke's labBKE14130 (darB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTTBKK14130 (darB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTTGP2800 (ΔdarB-ccpC]::phleo), available in Jörg Stülke's lab Expression vectors
pGP2929 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's labpGP635: expression of Strep-ykuL by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's labpGP767: expression of ykuL-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's labpGP3306: expression of ykuL by pBQ200 in B. subtilis, available in Jörg Stülke's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab FLAG-tag construct
References
Loading