SubtiBank SubtiBank
codY [2019-01-08 13:19:50]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

codY [2019-01-08 13:19:50]

regulation of a large regulon (more than 100 genes and operons) in response to branched-chain amino acid limitation
Locus
BSU16170
Isoelectric point
4.75
Molecular weight
28.86 kDa
Protein length
259 aa Sequence Blast
Gene length
777 bp Sequence Blast
Function
regulation of a large regulon in response to branched-chain amino acid limitation
Product
transcriptional pleiotropic repressor
Essential
no
Synonyms

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
1,690,119 → 1,690,898

Phenotypes of a mutant

  • no swarming motility on B medium. PubMed
  • the mutation suppresses the mucoid phenotype of motA or motB mutants due to loss of DegU phosphorylation and concomitant reduced expression of the capB-capC-capA-capE operon PubMed
  • inactivation of codY suppresses the requirement of a relA sasA sasB triple mutant for branched chain amino acids, methionine and threonine PubMed
  • The protein

    Protein family

  • codY family (according to Swiss-Prot)
  • Domains

  • contains a GAF domain (ligand binding domain)
  • Modification

  • phosphorylation on Ser-215 PubMed
  • Effectors of protein activity

  • GTP and branched chained amino acids (BCAA) increase the affinity of CodY for its DNA target sequences PubMed
  • Structure

  • 5LOO (unliganded full-length protein) PubMed
  • 2B0L (C-terminal DNA-binding domain), 2GX5 (N-terminal Gaf domain)
  • Localization

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • information on binding sites can be found in the PRODORIC2 database
  • Expression and Regulation

    Operons

    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon
  • Regulation

  • repressed during growth in the presence of branched chain amino acids (CodY) PubMed
  • Additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to PubMed)
  • view in new tab

    Biological materials

    Mutant

  • GP566 available in Jörg Stülke's lab
  • GP2473 (codY::spc), available in Jörg Stülke's lab PubMed
  • a codY::erm mutant is available in Linc Sonenshein's lab
  • a codY::spc (BB1043) mutant is available in Linc Sonenshein's, Fabian Commichau's and Jörg Stülke's labs
  • BKE16170 (ΔcodY::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT
  • BKK16170 (ΔcodY::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP245, available in Jörg Stülke's lab
  • pBP616 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Fabian Commichau's lab)
  • pBP618 (C-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP382) (available in Fabian Commichau's lab)
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab
  • Labs working on this gene/protein

  • Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
  • Tony Wilkinson, York University, U.K. Homepage
  • Oscar Kuipers, University of Groningen, The Netherlands, Homepage
  • References

    Reviews

    Loading

    The CodY regulon

    Loading

    Original Publications

    Loading