You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
sdhB [2019-02-04 16:07:30]
Molecular weight
28.27 kDa
Product
succinate dehydrogenase (iron-sulfur protein)
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,905,571 2,906,332
The protein
Catalyzed reaction/ biological activity
Succinate acceptor = fumarate reduced acceptor (according to Swiss-Prot)Protein family
succinate dehydrogenase/fumarate reductase iron-sulfur protein family (according to Swiss-Prot)Cofactors
Effectors of protein activity
Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide PubMedActivated by Cytochrome b558 PubMed Structure
Localization
attached to the membrane PubMed Additional information
This enzyme is a trimer membrane-bound PubMed PubMedOne subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane PubMed PubMedAnother subunit is the flavoprotein one, required for FAD usage PubMed PubMedThe other subunit has an iron-sulphur domain necessary for the catalytic activity PubMed PubMedextensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at Proteopedia Expression and Regulation
Biological materials
Mutant
GP792 ∆(sdhC-sdhA-sdhB)::phleo, available in Jörg Stülke's labGP2342 ∆(sdhC-sdhA-sdhB)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labGP2343 ∆(sdhC-sdhA-sdhB)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labBKE28430 (sdhB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATGGTTTTTTGTTCACTCA, downstream forward: _UP4_TAAGAAGAAAAAACCTCTTCBKK28430 (sdhB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATGGTTTTTTGTTCACTCA, downstream forward: _UP4_TAAGAAGAAAAAACCTCTTC GFP fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Stülke lab FLAG-tag construct
Antibody
**References
Reviews
Loading
Original publications
Loading