You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yabR
similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1
Molecular weight
14.05 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
69,626 70,012
The protein
Protein family
Peptidase U57 family (together with YabG) (according to UniProt) Paralogous protein(s)
Domains
S1 domain (aa 4 ... 74) (according to the Interpro database) Structure
Expression and Regulation
Operons
Sigma factors
SigM: sigma factor, PubMed, in SigM regulonSigE: sigma factor, PubMed, in SigE regulonSigW: sigma factor, PubMed, in SigW regulonSigD: sigma factor, PubMed, in SigD regulonSigX: sigma factor, PubMed, in SigX regulon Regulation
view in new tabRegulation
expressed during sporulation (SigE) PubMed and under stress conditions Additional information
there are about 50,000 molecules of DivIC per cell PubMed view in new tabBiological materials
Mutant
MGNA-B919 (yabR::erm), available at the NBRP B. subtilis, JapanBKE00630 (yabR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAABKK00630 (yabR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA References
Loading