You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cwlT [2018-06-07 18:57:54]
cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP
Molecular weight
36.39 kDa
Function
conjugative transfer of ICEBs1
Product
cell wall hydrolase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
544,022 → 545,011
The protein
Catalyzed reaction/ biological activity
hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D-γ-glutamate and meso-diaminopimelic acid) PubMed Protein family
nlpC/p60 family (according to Swiss-Prot)Domains
N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine PubMedC-terminal endopeptidase domain cleaves the bond between D-γ-glutamate and meso-diaminopimelic acid PubMed Localization
secreted (with signal peptide) PubMedmay be a lipoprotein, but the lipid anchor is not required for function PubMed Expression and Regulation
Operons
Regulatory mechanism
Regulation
strongly induced in the presence of salt (1.2 M NaCl) PubMed view in new tabBiological materials
Mutant
BKE04970 (ΔcwlT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAABKK04970 (ΔcwlT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAA References
Loading