ftsE [2019-09-02 12:53:09]

ABC transporter (ATP-binding protein) (FtsE-FtsX), required for CwlO activity (cell elongation) and for proper activation of Spo0A and initiation of sporulation

Locus: BSU_35260

Isoelectric point: 8.42

Molecular weight: 25.47 kDa

Protein length: 228 aa

Gene length: 687 bp

Function: control of cell wall synthesis

Product: ABC transporter (ATP-binding protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Autolytic activity required for peptidoglycan synthesis (cell elongation)
• Cellular processes → Transporters → ABC transporters → Regulatory ABC transporters
• Information processing → Regulation of gene expression → phosphorelay
• Lifestyles → Sporulation → phosphorelay
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,624,821 3,625,507

Phenotypes of a mutant

• a ftsE mutation is synthetically lethal with a lytE mutation (due to a lack of autolysin activity) PubMed
• shorter, fatter cells, this can be rescued by addition of Mg(2+) PubMed
• reduced growth rate, especially at low Mg(2+) concentrations PubMed

The protein

Catalyzed reaction/ biological activity

• necessary for the autolysin activity of CwlO PubMed

Protein family

• ABC transporter superfamily (according to UniProt)

Paralogous protein(s)

• YknY, YtrE, YxdL, PsdA, YvrO

Structure

• 3TIF (ATP-binding protein from Methanococcus jannaschii, 40% identity) PubMed

Localization

• membrane associated (via FtsX) PubMed

Expression and Regulation

Operons

• Genes: ftsE-ftsX
  Description: (according to DBTBS) null

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

Biological materials

Mutant

• BKE35260 (ftsE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAATCACCTAATCTTT, downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
• BKK35260 (ftsE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAATCACCTAATCTTT, downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG

References

Loading