gamA

glucosamine-6-phosphate deaminase

Locus: BSU_02360

Isoelectric point: 5.79

Molecular weight: 27.14 kDa

Protein length: 249 aa

Gene length: 750 bp

Function: glucosamine utilization

Product: glucosamine-6-phosphate deaminase

Essential: no

Synonyms: ybfT

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Utilization of cell wall components
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of amino sugars
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of nitrogen sources other than amino acids → Utilization of amino sugars

Gene

Coordinates: 256,823 257,572

Phenotypes of a mutant

• no growth on glucosamine PubMed

The protein

Catalyzed reaction/ biological activity

• α-D-glucosamine 6-phosphate + H₂O --> β-D-fructose 6-phosphate + NH₄⁺ (according to UniProt)

Protein family

• glucosamine/galactosamine-6-phosphate isomerase family (with NagB, according to UniProt)

Paralogous protein(s)

• NagB

Kinetic information

• K(M): 3.0 mM PubMed

Structure

• 2BKX (the structure of NagB, 50% identity) PubMed

Expression and Regulation

Operons

• Genes: gamA-gamP
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GamR: repression, PubMed, in GamR regulon

  Regulation

  • induced by glucosamine (GamR) PubMed

Biological materials

Mutant

• MGNA-B938 (ybfT::erm), available at the NBRP B. subtilis, Japan
• BKE02360 (gamA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT
• BKK02360 (gamA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT

References

Loading