fadR [2019-09-02 11:30:34]

transcriptional repressor (TetR family), regulation of fatty acid degradation

Locus: BSU_28550

Isoelectric point: 6.12

Molecular weight: 21.83 kDa

Protein length: 194 aa

Gene length: 585 bp

Function: regulation of fatty acid degradation

Product: transcriptional repressor

Essential: no

Synonyms: ysiA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Lipid metabolism → Utilization of lipids → Utilization of fatty acids
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 2,917,957 2,918,541

The protein

Protein family

• TetR family

Effectors of protein activity

• long chain fatty acids act as inducers that release FadR from its operator sites PubMed

Structure

• 3WHB PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: lcfA-fadR-fadB-etfB-etfA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • FadR: repression, PubMed, in FadR regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • induced by long chain acyl-CoA (C14 ... C20) (FadR) PubMed
  • expression of the operon is strongly induced during biofilm formation PubMed

• Genes: fadR-fadB-etfB-etfA
  Description: PubMed

  Regulation

  • induced by long-chain fatty acids (FadR) PubMed

Biological materials

Mutant

• MGNA-B008 (ysiA::erm), available at the NBRP B. subtilis, Japan
• 1A853 ( fadR::cat), PubMed, available at BGSC
• BKE28550 (fadR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT
• BKK28550 (fadR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT

References

Reviews

Loading

Original publications

Loading