yqgP

intramembrane protease

Locus: BSU_24870

Isoelectric point: 5.51

Molecular weight: 56.27 kDa

Protein length: 507 aa

Gene length: 1524 bp

Function: cell division

Product: intramembrane protease

Essential: no

Synonyms: glpG,gluP

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Proteolysis → Additional proteins involved in proteolysis
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,571,907 2,573,430

Phenotypes of a mutant

• filamentous phenotype PubMed

The protein

Catalyzed reaction/ biological activity

• Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to UniProt)
• cleavage of MgtE between its first and second trans-membrane helix at low magnesium concentration or high manganese or zinc concentrations to prevent uptake of toxic metal ions PubMed
• acts as adapter protein for FtsH PubMed

Protein family

• peptidase S54 family (according to UniProt)

Paralogous protein(s)

• YdcA: peptidase S54 family

Domains

• two tetratrichopeptide repeats (according to UniProt)

Effectors of protein activity

• Mn²⁺ and Zn²⁺ bind to the N-terminal cytosolic domain of YqgE to stimulate MgtE degradation PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: yqgP-yqgO-glcK-yqgS
  Description: PubMed

  Additional information

  • PhoP∼P binds to the promoter region, but regulation has not been explored PubMed

Biological materials

Mutant

• MGNA-C445 (yqgP::erm), available at the NBRP B. subtilis, Japan
• BKE24870 (yqgP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
• BKK24870 (yqgP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG

References

Reviews

Loading

Original publications

Loading