gltC

transcriptional activator/ repressor of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon, activates expression of the operon in the absence of arginine, represses in the presence of glutamate

locus: BSU_18460

pI: 5.62

mw: 33.87 kDa

protein length: 300 aa

gene length: 903 bp

function: regulation of the glutamate synthase operon ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])

product: transcriptional regulator ([SW|LysR family])

essential: No

synonyms

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]

Gene

Coordinates: 2,014,779 2,015,681

Phenotypes of a mutant

• ''gltC'' mutants are auxotrophic for glutamate, this can be suppressed by the [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]24 mutation or by amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] genomic region [pubmed|9023181,28294562]

The protein

Catalyzed reaction/ biological activity

• transcription activation of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon [Pubmed|2548995]

Protein family

• [SW|LysR family] (according to UniProt) [Pubmed|2548995]

[SW|Domains]

• DNA-binding helix-turn-helix motif: AA 18 ... 37
• [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)

Effectors of protein activity

• 2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation [Pubmed|17134717]

Structure

• [PDB|2H99] (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) [pubmed|19400783]

additional information

• information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000048 PRODORIC2 database]

Expression and Regulation

Operons

• genes: [gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: auto-repression, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]

  regulation

  • autoregulation by GltC [Pubmed|2548995]

Biological materials

Mutant

• GP344 (erm), (available in [SW|Jörg Stülke]'s lab)
• GP738 (gltC::Tn10, spc), (available in [SW|Jörg Stülke]'s lab)
• GP1904 (''gltC''::''aphA3''), (available in [SW|Jörg Stülke]'s lab) [pubmed|28294562]
• BKE18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
• BKK18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC

Expression vectors

• for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP903, available in [SW|Jörg Stülke]'s lab
• for expression, purification in ''E. coli'' with C-terminal Strep-tag, in pET3C: pGP951, available in [SW|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

Antibody

• available in [SW|Jörg Stülke]'s lab

labs

• [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
• [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
• [SW|Fabian Commichau] Senftenberg, Germany [http://www.uni-goettingen.de/de/413008.html homepage]

References

Reviews

• 20408793,22625175

Original Publications

• 7559360,15150225,2548995,17183217,17608797,17134717,14523131,20630473,25711804,28294562,19400783,31649652