gltC

transcriptional activator/ repressor of the gltA-gltB operon, activates expression of the operon in the absence of arginine, represses in the presence of glutamate

Locus: BSU_18460

Isoelectric point: 5.62

Molecular weight: 33.87 kDa

Protein length: 300 aa

Gene length: 903 bp

Function: regulation of the glutamate synthase operon (gltA-gltB)

Product: transcriptional regulator (LysR family)

Essential: No

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 2,014,779 2,015,681

Phenotypes of a mutant

• gltC mutants are auxotrophic for glutamate, this can be suppressed by the gltR24 mutation or by amplification of the gltA-gltB genomic region PubMed

The protein

Catalyzed reaction/ biological activity

• transcription activation of the gltA-gltB operon PubMed

Protein family

• LysR family (according to UniProt) PubMed

Domains

• DNA-binding helix-turn-helix motif: AA 18 ... 37
• HTH lysR-type domain (aa 1-58) (according to UniProt)

Effectors of protein activity

• 2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation PubMed

Structure

• 2H99 (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: gltC
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GltC: auto-repression, PubMed, in GltC regulon

  Regulation

  • autoregulation by GltC PubMed

Biological materials

Mutant

• GP344 (erm), (available in Jörg Stülke's lab)
• GP738 (gltC::Tn10, spc), (available in Jörg Stülke's lab)
• GP1904 (gltC::aphA3), (available in Jörg Stülke's lab) PubMed
• BKE18460 (gltC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
• BKK18460 (gltC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP903, available in Jörg Stülke's lab
• for expression, purification in E. coli with C-terminal Strep-tag, in pET3C: pGP951, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage
• Fabian Commichau Senftenberg, Germany homepage

References

Reviews

Loading

Original Publications

Loading