rny [2019-08-30 16:15:14]

RNase Y, 5 end sensitive endoribonuclease, involved in the degradation/ processing of mRNA, part of the putative RNA degradosome

Locus: BSU_16960

Isoelectric point: 5.39

Molecular weight: 58.75 kDa

Protein length: 520 aa

Gene length: 1563 bp

Function: RNA processing and degradation

Product: RNase Y

Essential: no

E.C.: 3.1.4.16

Synonyms: ymdA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → RNases → Endoribonucleases
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation
• Groups of genes → Quasi-essential genes
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,767,310 1,768,872

Phenotypes of a mutant

• transcription profile resulting from rny depletion: GEO PubMed
• defect in spore germination PubMed
• the mutant is strongly impaired in sporulation, genetic competence and many other phenotypes PubMed
• it is not possible to construct a rnjA rny double mutant PubMed

The protein

Catalyzed reaction/ biological activity

• processing, maturation and degradation of mRNAs, see RNase Y targets
• RNase Y cleaves S-box mgtE riboswitch RNAs in vivo and in vitro PubMed
• preference for 5' monophosphorylated substrate in vitro PubMed
• endonucleolytic cleavage PubMed
• required for the processing of the gapA operon mRNA PubMed
• cleavage activity appears sensitive to downstream secondary structure PubMed
• RNase Y initiates the degradation of rpsO mRNA PubMed
• RNase Y is responsible for the degradation of 23S rRNA, 16S rRNA, and mRNAs in aging spores PubMed
• RNase Y cleaves the leader of the cwlO mRNA at a stem-loop structure PubMed
• 3' end maturation of RNase P RNA and scRNA PubMed

Protein family

• RNase Y family (single member, according to UniProt)

Domains

• transmembrane domain (aa 524) PubMed
• coiled-coiled domain (may form a leucine zipper) (aa 30-150) PubMed
• KH domain (aa 210280) PubMed
• HD domain (aa 330430) PubMed
• C-terminal domain (aa 430-520) PubMed

Cofactors

• requires Mg 2, which can be replaced by Zn 2 or Mn 2 ions, PubMed

Effectors of protein activity

• appears sensitive to downstream secondary structure PubMed
• interaction of RNase Y with the complex of YmcA-YlbF-YaaT stimulates the degradation and maturation of several polycistronic mRNAs PubMed

Structure

• 6F7T (the N-teminal part, aa 1 ... 218) PubMed

Localization

• cell membrane, single-pass membrane protein PubMed
• forms foci at the site of septation PubMed

Additional information

• required for the processing of the gapA operon mRNA

Expression and Regulation

Operons

• Genes: rny-ymdB
  Description: PubMed

  Regulation

  • constitutive

  Additional information

  • the transcription terminator between rny and ymdB is strong and NusA-independent Reference

• Genes: rny
  Description: PubMed

  Regulation

  • constitutive

  Additional information

  • the transcription terminator between rny and ymdB is strong and NusA-independent Reference

Biological materials

Mutant

• 4043 (rny under p-spac control, cat), GP193 (rny under p-xyl control, cat), both available in Jörg Stülke's lab
• SSB447 (rny under P-spac control, erm) available in Putzer lab
• GP2501 (rny::spc), available in Jörg Stülke's lab
• GP2524 (rny::ermC), available in Jörg Stülke's lab
• BKE16960 (rny::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTTTCACCTCCTCTTG, downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
• BKK16960 (rny::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTTTCACCTCCTCTTG, downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT

Expression vectors

• N-terminal Strep-tag, expression in E. coli, in pGP172: pGP441, available in Jörg Stülke's lab
• pGP2813: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• N-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP380: pGP775, available in Jörg Stülke's lab
• C-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP382: pGP1852, available in Jörg Stülke's lab
• Expression of RNase Y missing the N-terminal transmembrane domain (25aa) as an intein fusion in E. coli (no tag left in the purified protein) available in the Putzer lab
• wild type rny, expression in B. subtilis, in pBQ200: pGP1201, available in Jörg Stülke's lab
• there is also a series of domain constructs present in pBQ200, all available in Jörg Stülke's lab
• chromosomal expression of Rny-Strep, spc: GP1033, available in Jörg Stülke's lab

LacZ fusion

• pGP459 (in pAC7), available in Jörg Stülke's lab

GFP fusion

• B. subtilis 3569 (amyE:: (p-xyl rny-gfpmut1-spc)), available in Errington lab
• pGP1368 for chromosomal expression of rny-YFP, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

FLAG-tag construct

• GP1030 (spc, based on pGP1331), available in Jörg Stülke's lab

Antibody

• available in van Dijl and in Jörg Stülke's lab

Labs working on this gene/protein

• Ciaran Condon, IBPC Paris, France Homepage
• Harald Putzer, IBPC Paris, France Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original publications

Loading

Publications on homologs from other organisms

Loading