yjbH

adaptor protein for ClpX-ClpP-catalyzed Spx degradation, confers resistance against nitrosating agents

Locus: BSU_11550

Isoelectric point: 5.21

Molecular weight: 31.33 kDa

Protein length: 299 aa

Gene length: 900 bp

Function: stimulation of Spx degradation

Product: adaptor protein

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Proteolysis → Additional proteins involved in proteolysis
• Lifestyles → Coping with stress → Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)

Gene

Coordinates: 1,233,614 1,234,513

Phenotypes of a mutant

• increased thermotolerance due to increased stabiliy of Spx and thus increased expression of trxA PubMed

The protein

Catalyzed reaction/ biological activity

• adaptor protein for ClpX-ClpP-catalyzed Spx degradation PubMed

Protein family

• UPF0413 family (single member, according to UniProt)

Cofactors

• contains Zn atoms (coordinated by the N-terminal His-rich region) PubMed

Effectors of protein activity

• YjbH aggregates under stress conditions, resulting in the inability to bind to Spx, and therefore in stabilization of Spx PubMed
• Zn atom is released upon treatment with strong oxidants PubMed
• interaction with YirB inhibits the formation of a complex with Spx PubMed

Structure

• 6GHB (oxidized Geobacillus kaustophilus protein complexed with B. subtilis Spx) PubMed
• 6GHO (Geobacillus kaustophilus protein complexed with B. subtilis Spx) PubMed

Localization

• cytosolic protein

Expression and Regulation

Operons

• Genes: yjbI-yjbH
  Description: PubMed

  Regulatory mechanism

  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • induced by cell wall stress (Spx) PubMed

  Additional information

  • A ncRNA is predicted between yizD and yjbH PubMed

Biological materials

Mutant

• GP2645 (yjbH::erm), available in Jörg Stülke's lab
• BKE11550 (yjbH::erm, available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE11550 (yjbH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
• BKK11550 (yjbH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Peter Zuber, Oregon Health and Science University, USA
• Homepage
• Claes von Wachenfeldt, Lund University, Sweden Homepage

References

Reviews

Loading

Original Publications

Loading