You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
motA [2019-03-22 10:31:39]
Molecular weight
29.19 kDa
Product
flagellar stator subunit
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,434,433 1,435,245
Phenotypes of a mutant
loss of swimming and swarming motility PubMedmucoid phenotype due to the DegU-P activated overexpression of the capB-capC-capA-capE operon and resulting overproduction of poly-gamma-glutamate PubMednot essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed The protein
Protein family
motA family (according to Swiss-Prot)Paralogous protein(s)
Effectors of protein activity
Localization
anchored to the cell wall, extending through the cell membrane PubMed Expression and Regulation
Biological materials
Mutant
1A631 ( motA::erm), PubMed, available at BGSC1A923 ( motA::erm), PubMed, available at BGSCDS7498 (marker-less in NCIB3610) PubMedBKE13690 (motA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGCBKK13690 (motA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGC References
Loading