dtd [2019-07-08 09:48:02]

D-aminoacyl-tRNA deacylase

locus: BSU27590

pI: 4.35

mw: 14.35 kDa

protein length: 132 aa

gene length: 399 bp

function: prevention of misincorporation of D-amino acids into proteins

product: D-aminoacyl-tRNA deacylase

essential: no

synonyms: yrvI

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]

Gene

Coordinates: 2,820,077 2,820,475

Phenotypes of a mutant

• D-amino acids are toxic [Pubmed|24097941]
• due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 [Pubmed|24097941]

The protein

Protein family

• DTD family (according to Swiss-Prot)

Structure

• [PDB|2DBO] (from Aquifex aeolicus, 55% identity)

Additional information

• due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 [Pubmed|24097941]

Expression and Regulation

Operons

• genes: [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]-[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]
  description: [Pubmed|9383190]

Biological materials

Mutant

• MGNA-A825 (yrvI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/825 NBRP B. subtilis, Japan]
• BKE27590 ([gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG, downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG
• BKK27590 ([gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG, downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG

References

• 9383190,24097941,14527667,15292242