frlN

aminosugar ABC transporter (permease)

Locus: BSU_32590

Isoelectric point: 5.29

Molecular weight: 32.68 kDa

Protein length: 292 aa

Gene length: 879 bp

Function: uptake of sugar amines

Product: aminosugar ABC transporter (permease)

Essential: no

Synonyms: yurN

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of amino sugars
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of nitrogen sources other than amino acids → Utilization of amino sugars
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,348,825 3,349,703

The protein

Protein family

• Binding-protein-dependent transport system permease family (according to UniProt)
• MalFG subfamily (according to UniProt)

Domains

• ABC transmembrane type-1 domain (aa 66-282) (according to UniProt)

Structure

• 4TQU (from Sphingomonas sp., 28% identity) PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: frlB-frlO-frlN-frlM-frlD-yurJ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CodY: repression, PubMed, PubMed, in CodY regulon
  • FrlR: repression, PubMed, in FrlR regulon
  • YlxR: regulation, PubMed, in YlxR regulon

  Regulation

  • FrlB: repressed during growth in the presence of branched chain amino acids (CodY) PubMed
  • induced in the absence of YlxR PubMed

  Additional information

  • the frlB-frlO-frlN-frlM-frlD-yurJ operon is strongly downregulated in a cshA mutant PubMed

Biological materials

Mutant

• MGNA-A560 (yurN::erm), available at the NBRP B. subtilis, Japan
• BKE32590 (frlN::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGGGTATCTCATCTCCTT, downstream forward: _UP4_AAAACCGGAAAGGAGGAGTA
• BKK32590 (frlN::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGGGTATCTCATCTCCTT, downstream forward: _UP4_AAAACCGGAAAGGAGGAGTA

References

Loading