You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
sdhC [2019-02-04 16:00:42]
succinate dehydrogenase (cytochrome b558 subunit)
Molecular weight
22.79 kDa
Product
succinate dehydrogenase (cytochrome b558 subunit)
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,908,129 2,908,737
Phenotypes of a mutant
defective in the the ability to support the growth of Synechococcus leopoliensis CCAP1405/1 on agar media PubMed The protein
Protein family
cytochrome b558 family (according to Swiss-Prot)Cofactors
FeEffectors of protein activity
Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide PubMedActivated by Cytochrome b558 PubMed Structure
Localization
Additional information
This enzyme is a trimer membrane-bound PubMed PubMedOne subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane PubMed PubMedAnother subunit is the flavoprotein one, required for FAD usage PubMed PubMedThe other subunit has an iron-sulphur domain necessary for the catalytic activity PubMed PubMedextensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at Proteopedia Expression and Regulation
Biological materials
Mutant
MGNA-B028 (sdhC::erm), available at the NBRP B. subtilis, JapanGP743 ∆(sdhC-sdhA), cat, available in Jörg Stülke's labGP792 (sdhC-sdhA-sdhB)::phleo, available in Jörg Stülke's labGP2342 (sdhC-sdhA-sdhB)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labGP2343 (sdhC-sdhA-sdhB)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labBKE28450 (sdhC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAGBKK28450 (sdhC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab References
Reviews
Loading
Original publications
Loading