sdhC

succinate dehydrogenase (cytochrome b558 subunit)

Locus: BSU_28450

Isoelectric point: 9.83

Molecular weight: 22.79 kDa

Protein length: 202 aa

Gene length: 609 bp

Function: TCA cycle

Product: succinate dehydrogenase (cytochrome b558 subunit)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,908,129 2,908,737

Phenotypes of a mutant

• defective in the the ability to support the growth of Synechococcus leopoliensis CCAP1405/1 on agar media PubMed
• defective in biofilm formation PubMed

The protein

Protein family

• cytochrome b558 family (single member, according to UniProt)

Cofactors

• Fe

Effectors of protein activity

• Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide PubMed
• Activated by Cytochrome b558 PubMed

Structure

• 1NEK (E. coli) PubMed

Localization

• membrane protein PubMed

Additional information

• This enzyme is a trimer membrane-bound PubMed PubMed
• One subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane PubMed PubMed
• Another subunit is the flavoprotein one, required for FAD usage PubMed PubMed
• The other subunit has an iron-sulphur domain necessary for the catalytic activity PubMed PubMed
• extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at Proteopedia

Expression and Regulation

Operons

• Genes: sdhC-sdhA-sdhB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutive

Other regulations

• FsrA: translation inhibition, PubMed

Additional information

• highly expressed at high iron concentrations PubMed

Biological materials

Mutant

• MGNA-B028 (sdhC::erm), available at the NBRP B. subtilis, Japan
• GP743 ∆(sdhC-sdhA)::cat, available in Jörg Stülke's lab
• GP792 ∆(sdhC-sdhA-sdhB)::phleo, available in Jörg Stülke's lab
• GP2342 ∆(sdhC-sdhA-sdhB)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• GP2343 ∆(sdhC-sdhA-sdhB)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• BKE28450 (∆sdhC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG
• BKK28450 (∆sdhC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading