You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ypfD [2018-12-03 16:54:32]
similar to ribosomal protein S1
Molecular weight
42.24 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,394,664 → 2,395,812
The protein
Protein family
ribosomal protein S1P family (according to Swiss-Prot)Domains
4 reiterated S1-like domains (aa 16 ...84, aa 102 ... 167, aa 188 ... 256, aa 273 ... 342)Modification
phosphorylation on Ser-243 PubMed Structure
5X8R (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) PubMed1SRO (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) PubMed Localization
cytoplasm (according to Swiss-Prot)Additional information
Expression and Regulation
Biological materials
Mutant
BKE22880 (ΔypfD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGACBKK22880 (ΔypfD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC References
Loading