You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ugtP [2020-10-30 15:16:06]
UDP-glucose diacylglycerol glucosyltransferase, growth-rate dependent inhibitor of
Cell divisionMolecular weight
43.40 kDa
Function
synthesis of glucolipids and anchoring of lipoteichoic acid, inhibition of
FtsZ assembly
Product
UDP-glucose diacylglycerol glucosyltransferase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,306,514 2,307,662
Phenotypes of a mutant
cells are bent and distended due to the lack of glucolipids PubMeda ugtP lytE double mutant has a severe cell shape defect, thi can be suppressed by mutations resulting in reduced expression or activity of PbpA PubMedincreased expression of the SigM, SigV, and SigX regulons PubMedaltered localization of MreB (irregular clusters instead of helical dots) PubMedthe inactivation of ugtP suppresses the poor and filamentous growth of the whiA zapA double mutant PubMedincreased conjugation of ICEBs1 PubMed The protein
Catalyzed reaction/ biological activity
1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)1,2-diacyl-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + H+ + UDP (according to UniProt)the interaction with FtsZ results in inhibition of cell division and an increase of cell size PubMed Protein family
glycosyltransferase 28 family (with YkoN and MurG, according to UniProt) Effectors of protein activity
oligomerization of UgtP is inhibited by UDP-Glc and by interaction with FtsZ PubMedthe amounts of UgtP are reduced about threefold during growth with poor carbon sources due to ClpP-dependent degradation (this requires most likely ClpX as the chaperone, but ClpC and ClpE are also effective) PubMed Structure
4X1T (galactolipid synthase from Arabidopsis thaliana, 25% identity) PubMed Localization
membrane-bound protein, self-assembles into tightly wound spirals in vitro PubMedunder nutrient rich conditions (increased concentration of UDP-Glc): throughout the cell, concentrated at the cell poles and/or the cytokinetic ring, interaction with FtsZ PubMedunder nutrient poor conditions: forms punctate foci (oligomers), no interaction with FtsZ PubMed Expression and Regulation
Operons
Additional information
the amounts of UgtP are reduced about threefold during growth with poor carbon sources due to ClpP-dependent degradation PubMed Biological materials
Mutant
MGNA-A886 (ypfP::erm), available at the NBRP B. subtilis, JapanGP1369 (ugtP::spc), available in Jörg Stülke's labBKE21920 (ugtP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCABKK21920 (ugtP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA Expression vectors
pGP2571, for expression in B. subtilis (based on pBQ200, available in Jörg Stülke's labpGP2600, for expression/ purification from E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab References
Reviews
Loading
Original Publications
Loading