ugtP [2017-11-17 10:39:24]

UDP-glucose diacylglycerol glucosyltransferase, growth-rate dependent inhibitor of Cell division

Locus: BSU21920

Isoelectric point: 8.40

Molecular weight: 43.40 kDa

Protein length: 382 aa

Gene length: 1146 bp

Function: synthesis of glucolipids and anchoring of lipoteichoic acid, inhibition of FtsZ assembly

Product: UDP-glucose diacylglycerol glucosyltransferase

Essential: no

E.C.: 2.4.1.315

Synonyms: ypfP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell shape
• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Metabolism → Lipid metabolism → Lipid metabolism/ other
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,306,514 → 2,307,662

Phenotypes of a mutant

• cells are bent and distended due to the lack of glucolipids PubMed
• increased expression of the SigM, SigV, and SigX regulons PubMed
• altered localization of MreB (irregular clusters instead of helical dots) PubMed
• the inactivation of ugtP suppresses the poor and filamentous growth of the whiA zapA double mutant PubMed
• increased conjugation of ICEBs1 PubMed

The protein

Catalyzed reaction/ biological activity

• UDP-glucose + 1,2-diacylglycerol = UDP + 1,2-diacyl-3-(O-beta-D-glucopyranosyl)-sn-glycerol (according to Swiss-Prot)
• the interaction with FtsZ results in inhibition of cell division and an increase of cell size PubMed

Effectors of protein activity

• oligomerization of UgtP is inhibited by UDP-Glc and by interaction with FtsZ PubMed

Structure

• 4X1T (galactolipid synthase from Arabidopsis thaliana, 25% identity)

Localization

• membrane-bound protein, self-assembles into tightly wound spirals in vitro PubMed
• under nutrient rich conditions (increased concentration of UDP-Glc): throughout the cell, concentrated at the cell poles and/or the cytokinetic ring, interaction with FtsZ PubMed
• under nutrient poor conditions: forms punctate foci (oligomers), no interaction with FtsZ PubMed

Expression and Regulation

Operons

• Genes: ugtP
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon

• Genes: metA-ugtP
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon

Biological materials

Mutant

• MGNA-A886 (ypfP::erm), available at the NBRP B. subtilis, Japan
• GP1369 (ugtP::spc), available in Jörg Stülke's lab
• BKE21920 (ΔugtP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
• BKK21920 (ΔugtP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA

Expression vector

• pGP2571, for expression in B. subtilis (based on pBQ200, available in Jörg Stülke's lab
• pGP2600, for expression/ purification from E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading