zagA

zinc metallochaperone, ZTP activated GTPase A

Locus: BSU_03360

Isoelectric point: 4.40

Molecular weight: 45.15 kDa

Protein length: 397 aa

Gene length: 1194 bp

Function: supply of zinc from RpmE to FolE

Product: ZTP activated GTPase A

Essential: no

Synonyms: yciC

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo) → Zinc
• Information processing → Targets of second messengers → Targets of ZTP
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 366,063 367,256

The protein

Catalyzed reaction/ biological activity

• has GTPase and ZTPase activity PubMed
• mobilization of zinc from RpmE (after insertion of RpmEB into the ribosome), to provide it to FolE PubMed
• the interaction with FolE facilitates the supply of zinc to FolE under conditions of zinc limitation PubMed

Protein family

• SIMIBI class G3E GTPase family (single member, according to UniProt)

Kinetic information

• K_M for GTP: 40 µM PubMed
• K_M for ZTP: 36 µM PubMed

Domains

• CobW C-terminal domain (aa 259-374) (according to UniProt)

Modification

• phosphorylated on Arg-58 PubMed

Effectors of protein activity

• ZTP (stimulates interaction with FolE) reference

Structure

• 1NIJ (YjiA from E. coli, 27% identity) PubMed

Localization

• membrane associated PubMed

Expression and Regulation

Operons

• Genes: yczL-zagA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Zur: repression, in the presence of zinc PubMed, in Zur regulon

• Genes: folEB-yciB-yczL-zagA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Zur: repression, in the presence of zinc PubMed, in Zur regulon

  Regulation

  • folE2: induced by zinc starvation (Zur) PubMed

Biological materials

Mutant

• MGNA-B999 (yciC::erm), available at the NBRP B. subtilis, Japan
• BKE03360 (zagA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT
• BKK03360 (zagA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Reviews

Loading

Original publications

Loading