You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yhfR
phosphatase involved in isopentenol (isoprenoid) biosynthesis
Molecular weight
21.85 kDa
Function
isoprenoid biosynthesis
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,108,736 1,109,317
Phenotypes of a mutant
no detectable phenotype PubMed The protein
Catalyzed reaction/ biological activity
phosphatase involved in isopentenol (isoprenoid) biosynthesisProtein family
similar to 2,3-diphosphoglycerate-dependent phosphoglycerate mutases PubMed Structure
Additional information
The gene is annotated in KEGG as an ortholog of phosphoglycerate mutase (PGM) EC 5.4.2.1. In MetaCyc the protein is marked as similar to phosphoglycerate mutase. No EC annotation is available in Swiss-Prot. Pearson et al. (PubMed) demonstrated that yhfR is non-essential for growth, sporulation, and spore germination. They also purified the gene, expressed it in B. subtilis but were not able to detect PGM activity in B. subtilis. PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A243 (yhfR::erm), available at the NBRP B. subtilis, JapanBKE10340 (yhfR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAATCCCCTTCCTGAC, downstream forward: _UP4_TAAGAAAAAGACAGGCGTTTBKK10340 (yhfR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAATCCCCTTCCTGAC, downstream forward: _UP4_TAAGAAAAAGACAGGCGTTT References
Loading