tuaH

sugar transferase

Locus: BSU_35540

Isoelectric point: 8.03

Molecular weight: 45.43 kDa

Protein length: 397 aa

Gene length: 1194 bp

Function: biosynthesis of teichuronic acid

Product: sugar transferase

Essential: no

Synonyms: yvhH

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of teichuronic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of teichuronic acid
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other

Gene

Coordinates: 3,649,875 3,651,068

The protein

Protein family

• glycosyltransferase 1 family (according to UniProt)

Expression and Regulation

Operons

• Genes: tuaA/2-tuaA/1-tuaB-tuaC-tuaD-tuaE-tuaF-tuaG-tuaH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • PhoP: activation, PubMed, in PhoP regulon

  Regulation

  • expressed during sporulation in the forespore (SigF) PubMed

Biological materials

Mutant

• BKE35540 (tuaH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCTTCATCACCTTTTCTC, downstream forward: _UP4_TAGTCCTATAAATTGGGATG
• BKK35540 (tuaH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCTTCATCACCTTTTCTC, downstream forward: _UP4_TAGTCCTATAAATTGGGATG

Expression vector

• pGP2178 (expression in B. subtilis, in pBQ200), available in Jörg Stülke's lab

References

Loading