pbpF [2020-10-14 10:33:08]

class A penicillin-binding protein 2C

Locus: BSU_10110

Isoelectric point: 7.08

Molecular weight: 79.10 kDa

Protein length: 714 aa

Gene length: 2145 bp

Function: bifunctional glucosyltransferase/ transpeptidase, synthesis of spore peptidoglycan

Product: penicillin-binding protein 2C

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Penicillin-binding proteins
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,083,851 1,085,995

Phenotypes of a mutant

• a strain lacking all four class A penicillin-binding proteins (ponA pbpD pbpF pbpG) is severely inhibited for L-form switching in the presence of D-cycloserine PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of spore peptidoglycan (with PbpG) [pubmed| 11567005]
• [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol = [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H⁺ (according to UniProt)
• Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)

Protein family

• N-terminal part: glycosyltransferase 51 family (according to UniProt)
• C-terminal part: transpeptidase family (according to UniProt)

Paralogous protein(s)

• PbpD, PbpG, PonA

Structure

• 2OLU (from Staphylococcus aureus, aa 40-610, 32% identity) PubMed

Localization

• cell membrane, the major part is exposed to the outside (according to UniProt)
• prespore PubMed
• during vegetative growth: septal, low flourescence at periphery PubMed

Expression and Regulation

Operons

• Genes: pbpF
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigG: sigma factor, PubMed, in SigG regulon

  Regulation

  • expressed in mother cell and prespore PubMed

Biological materials

Mutant

• BKE10110 (pbpF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAACTCACCTCGCCTTT, downstream forward: _UP4_TAATGGAATTCGGCGATTTT
• BKK10110 (pbpF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAACTCACCTCGCCTTT, downstream forward: _UP4_TAATGGAATTCGGCGATTTT

GFP fusion

• 2084 trpC2 pbpF::pSG1491 (cat P_xyl-gfpa-pbpF1-335) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab

References

Loading