SubtiBank SubtiBank
glmR [2020-10-02 16:40:57]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

glmR [2020-10-02 16:40:57]

regulator of carbon partitioning between central metabolism and peptidoglycan biosynthesis, control of cell shape, required for correct localization of PBP1
Locus
BSU_34760
Isoelectric point
5.41
Molecular weight
34.53 kDa
Protein length
317 aa Sequence Blast
Gene length
954 bp Sequence Blast
Function
regulation of carbon partitioning between central metabolism and peptidoglycan biosynthesis, localization of PBP1
Product
activator of GlmS activity
Essential
no
Synonyms
yvcK

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
3,570,546 3,571,499

Phenotypes of a mutant

  • unable to grow with gluconeogenic substrates as single carbon source, this can be suppressed by mutations in cggR, zwf, pgpH, ltaS, yfnI, upon overexpression of glmS or by a point mutation in PgcA (G47S) that results in increased phosphoglucosamine mutase activity PubMed
  • filamentous or L-shape-like aberrant morphologies (suppressed by Mg2+) PubMed, this is supressed by overexpression of MreB or by deletion of PBP1, ltaS, or yfnI PubMed
  • a pgcA glmR double mutant is not viable, this can be suppressed by overexpression of GlmM PubMed
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates GlmS activity to facilitate the diversion of carbon from fructose-6-phosphate to peptidoglycan synthesis PubMed
  • Protein family

  • gluconeogenesis factor family (single member, according to UniProt)
  • Domains

  • phosphorylated on Thr-304 by PrkC, dephosphorylated by PrpC PubMed
  • Effectors of protein activity

  • binds UDP-GlcNAc PubMed, this prevents the stimulation of GlmS activity PubMed
  • Structure

  • 2O2Z (the protein from B. halodurans, 63% identity, 86% similarity)
  • Localization

  • localized as a helical-like pattern PubMed
  • Expression and Regulation

    Operons

    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • Regulatory mechanism

  • CcpA: repression, in CcpA regulon
  • Regulation

  • constitutive expression at both protein and RNA levels PubMed
  • Additional information

  • A ncRNA is predicted between 'yvcI' and 'trxB' PubMed
  • view in new tab

    Additional information

  • translation is likely to require Efp due to the presence of several consecutive proline residues PubMed
  • Biological materials

    Mutant

  • MGNA-B640 (yvcK::erm), available at the NBRP B. subtilis, Japan
  • BKE34760 (ΔglmR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • BKK34760 (ΔglmR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • Expression vectors

  • pGP736 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Boris Görke's lab
  • Labs working on this gene/protein

  • Anne Galinier, University of Marseille, France
  • References

    Reviews

    Loading

    Original publications

    Loading