greA

transcription elongation factor, resolves stalled RNA polymerase at promoter or promoter-proximal regions

Locus: BSU_27320

Isoelectric point: 4.00

Molecular weight: 17.00 kDa

Protein length: 157 aa

Gene length: 474 bp

Function: transcription elongation

Product: transcription elongation factor

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination → Other proteins
• Information processing → Genetics → Newly identified competence genes
• Information processing → RNA synthesis and degradation → Transcription → Transcription elongation/ termination

Gene

Coordinates: 2,791,494 2,791,967

Phenotypes of a mutant

• RNA polymerase accumulates in promoter-proximal regions of many genes PubMed
• non-transformable PubMed

The protein

Catalyzed reaction/ biological activity

• resolves stalled RNA polymerase at promoter or promoter-proximal regions
• required for repair of DNA lesions during growth PubMed
• promotes error-prone DNA repair during stress to promote genetic diversity PubMed

Protein family

• GreA/GreB family (single member, according to UniProt)

Structure

• 1GRJ (from E. coli, 43% identity) PubMed

Localization

• uniformly distributed throughout the nucleoid PubMed

Expression and Regulation

Operons

• Genes: trmR-yrrN-yrrO-udk-greA
  Description: PubMed

• Genes: greA
  Description: PubMed

Biological materials

Mutant

• BP351 (greA::cat) available in Fabian Commichau's lab
• GP2612 (greA::aphA3), available in Jörg Stülke's lab
• BKE27320 (greA::ermC) (available in the BGSC and in Jörg Stülke's lab)
• BKE27320 (greA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
• BKK27320 (greA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT, downstream forward: _UP4_TAATATCTGTTTAGCAGCGA

Expression vectors

• C-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP382: pGP2547, available in Jörg Stülke's lab PubMed

LacZ fusion

• pGP2546 in (pAC7), available in Jörg Stülke's lab
• GP2537 (kan), available in Jörg Stülke's lab

GFP fusion

• GP2527 (in pBP43), expression of greA-GFP::spc under the native promoter, available in Jörg Stülke's lab

FLAG-tag construct

• GP2525 (in pBP43), expression of greA-FLAG::spc under the native promoter, available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading