sigKC

RNA polymerase sporulation-specific sigma factor (SigK) (3' part of the interrupted sigK gene), with sigK

Locus: BSU_26390

Isoelectric point: 9.61

Molecular weight: 16.00 kDa

Protein length: 138 aa

Gene length: 417 bp

Function: late mother cell-specific gene expression

Product: RNA polymerase sporulation-specific sigma factor (SigK) (3' part of the interrupted sigK gene)

Essential: no

Synonyms: spoIIIC

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other

Gene

Coordinates: 2,701,338 2,701,754

The protein

Protein family

• sigma-70 factor family (according to UniProt)

Expression and Regulation

Operons

• Genes: sigKC
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon
  • SigK: sigma factor, PubMed, in SigK regulon

  Regulatory mechanism

  • GerE: repression, PubMed, in GerE regulon
  • SpoIIID: activation, PubMed, in SpoIIID regulon

  Regulation

  • expressed during sporulation in the mother cell (SigE, SigK, [protein|[GerE]], SpoIIID) PubMed

• Genes: yqaB-sigKC
  Description: PubMed

Biological materials

Mutant

• BKE26390 (sigKC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATGCATGAGGATTTCATTAT, downstream forward: _UP4_TAATGCAGAAGAAGCCGGAT
• BKK26390 (sigKC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATGCATGAGGATTTCATTAT, downstream forward: _UP4_TAATGCAGAAGAAGCCGGAT

References

The SigK regulon

Loading

Other original publications

Loading