mbl

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for CwlO activity

Locus: BSU_36410

Isoelectric point: 5.67

Molecular weight: 35.70 kDa

Protein length: 333 aa

Gene length: 1002 bp

Function: cell shape determination

Product: MreB-like protein

Essential: yes

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell shape
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Essential genes
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,747,254 3,748,255

Phenotypes of a mutant

• essential PubMed
• non-viable in the presence of low Mg(2 )
• readily accumulate rsgI suppressor mutants PubMed

The protein

Catalyzed reaction/ biological activity

• forms helical filaments in a heterologous system PubMed
• required for CwlO activity PubMed

Protein family

• FtsA/MreB family (according to UniProt)

Paralogous protein(s)

• MreB, MreBH

Structure

• 1JCF (MreB from Thermotoga maritima, 52% identity) PubMed

Localization

• during logarithmic growth, Mbl forms discrete patches that move processively along peripheral tracks perpendicular to the cell axis PubMed
• forms transverse bands as cells enter the stationary phase PubMed
• close to the inner surface of the cytoplasmic membrane PubMed
• reports on helical structures formed by Mbl PubMed seem to be misinterpretation of data PubMed
• Mbl patch speed depends on the growth rate, the faster growth, the higher the patch speed PubMed

Expression and Regulation

Operons

• Genes: mbl
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, promoter p1, upstream of Usd PubMed, in SigE regulon
  • SigA: sigma factor, promoter p2, upstream of Mbl PubMed, in SigA regulon

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed

  Additional information

  • An [ncRNA|search|antisense RNA] is predicted for 'mbl' PubMed

• Genes: usd-spoIIID-mbl
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed

  Additional information

  • An [ncRNA|search|antisense RNA] is predicted for 'mbl' PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• BKE36410 (mbl::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTATTTATATCCTCCTT, downstream forward: _UP4_TGATTTCACAAACCTCATTC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Boris Görke's lab

Antibody

• available in the Jeff Errington's and Peter Graumann's labs

Labs working on this gene/protein

• Peter Graumann, Freiburg University, Germany homepage

References

Localization

Loading

Other original publications

Loading