You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cinA [2019-07-02 08:54:30]
plays a nucleoid-associated general role in cells entering stationary phase
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
1,763,222 1,764,472
The protein
Protein family
cinA family (according to Swiss-Prot)Structure
[PDB|4CT8] (from Aquifex aeolicus, 33% identity) [pubmed|25313401][SW|Localization]
associated with the nucleoid [Pubmed|20480359]Biological materials
Mutant
MGNA-B122 (cinA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1121 NBRP B. subtilis, Japan]BKE16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTATBKK16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTATReferences