mgsR

transcriptional regulator of a subset of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] general stress regulon, required for protection against oxidative stress

locus: BSU_24770

pI: 9.28

mw: 14.68 kDa

protein length: 126 aa

gene length: 381 bp

function: controls a subset of general stress genes

product: transcriptional regulator

essential: no

synonyms: yqgZ

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]

Gene

Coordinates: 2,564,026 2,564,406

The protein

Catalyzed reaction/ biological activity

• exerts a positive or negative effect on the expression of 53 or 18 stress genes, respectively [Pubmed|18643936]

Protein family

• ArsC family (with [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and [protein|5278DD377B110CC14E239B9428F1985B472EEDF5|YusI], according to UniProt)

Paralogous protein(s)

• [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]

Modification

• [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [Pubmed|22812682]
• phosphorylation on R17, R95 by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB], this tags the protein for degradation by [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|32477307,30962353]

Structure

• [PDB|3L78] (from Streptococcus mutans, 42% identity)

Expression and Regulation

Operons

• genes: [gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]
  description: [Pubmed|18643936]

  sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|18643936], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]

  regulatory mechanism

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR]: activation, in [regulon|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR regulon]

  regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,18643936]

  additional information

  • [protein|search|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [PubMed|22812682]

additional information

• half-life of the protein: 6 minutes [pubmed|32477307]

Biological materials

Mutant

• MGNA-C476 (yqgZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2474 NBRP B. subtilis, Japan]
• BKE24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC
• BKK24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC

References

• 18643936,12107147,15805528,18643936,22812682,22582280,30962353,32477307