You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cpaA [2019-05-08 09:56:04]
Molecular weight
67.29 kDa
Function
export of potassium ions
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,240,356 1,242,200
The protein
Protein family
Monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family (with CpaA, according to UniProt) Domains
Effectors of protein activity
binds c-di-AMP, which likely activates export activity PubMed Structure
4BWZ (from Thermus thermophilus, corresponds to the transmembrane domain (aa 27 ... 402), 26% identity) PubMed4YS2 (S. aureus CpaA, the RCK_C domain in complex with c-di-AMP, 58% identity) Localization
cell membrane (according to UniProt)Expression and Regulation
Biological materials
Mutant
MGNA-B163 (yjbQ::erm), available at the NBRP B. subtilis, JapanGP2082 (cpaA::ermC), available in Jörg Stülke's labBKE11640 (cpaA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGGBKK11640 (cpaA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG Expression vectors
pGP2909 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab FLAG-tag construct
References
Loading