sacT [2018-02-10T14:28:51.000Z]

transcriptional antiterminator for the sacP-sacA-ywdA operon

locus: BSU38070

pI: 5.59

mw: 31.92 kDa

protein length: 276 aa

gene length: 828 bp

function: regulation of sucrose utilization

product: transcriptional antiterminator

essential: no

synonyms: ipa-47d

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.9|Phosphoproteins / Other]

Gene

Coordinates: 3,906,142 → 3,906,972

The protein

Catalyzed reaction/ biological activity

• binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)

Protein family

• [SW|PRD-containing transcription factors|transcriptional antiterminator] bglG family (according to Swiss-Prot) BglG family of antiterminators

Paralogous protein(s)

• [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]

[SW|Domains]

• N-terminal RNA binding domain [Pubmed|10610766]
• 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]

Modification

• Phosphorylated and inactivated by SacP (EII-Scr). (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
  description: [Pubmed|9353933]

  regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]

  regulation

  • repressed by casamino acids [Pubmed|12107147]

• genes: [gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]-[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]

  regulation

  • repressed by casamino acids [Pubmed|12107147]

  additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]

Biological materials

Mutant

• GP429 (spc), available in [SW|Jörg Stülke]'s lab
• BKE38070 (Δ[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
• BKK38070 (Δ[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG

Expression vector

• for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP166, available in [SW|Jörg Stülke]'s lab
• for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP426, available in [SW|Jörg Stülke]'s lab
• for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP427, available in [SW|Jörg Stülke]'s lab
• for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP439, available in [SW|Jörg Stülke]'s lab
• for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP440, available in [SW|Jörg Stülke]'s lab
• for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP571, available in [SW|Jörg Stülke]'s lab
• for expression of the RNA-binding domain in ''B. subtilis'', in [SW|pBQ200]: pGP446, available in [SW|Jörg Stülke]'s lab
• for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [SW|pGP382]: pGP1064, available in [SW|Jörg Stülke]'s lab
• for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [SW|pGP380]: pGP1068, available in [SW|Jörg Stülke]'s lab

GFP fusion

• GP1227 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab

FLAG-tag construct

• GP1223 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

References

Reviews

• 9663674,18086213

Original publications

• 12107147,2163394,1577686,8702561,1279678,21278164,26020636,22383849