sacT [2019-09-26 11:27:23]

transcriptional antiterminator for the sacP-sacA-ywdA operon

Locus: BSU_38070

Isoelectric point: 5.59

Molecular weight: 31.92 kDa

Protein length: 276 aa

Gene length: 831 bp

Function: regulation of sucrose utilization

Product: transcriptional antiterminator

Essential: no

Synonyms: ipa-47d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of sucrose
• Information processing → Regulation of gene expression → Transcription factors and their control → PRD-type regulators
• Information processing → Regulation of gene expression → RNA binding regulators
• Groups of genes → Phosphoproteins → Phosphoproteins / Other

Gene

Coordinates: 3,906,142 3,906,972

The protein

Catalyzed reaction/ biological activity

• binding to the mRNA of the sacP-sacA operon, causes transcription antitermination (in presence of sucrose and absence of glucose)

Protein family

• PRD-containing transcription factors

Paralogous protein(s)

• GlcT, SacY, LicT

Domains

• N-terminal RNA binding domain PubMed
• 2 x PRD (PtsI regulation domains) PubMed

Modification

• Phosphorylated and inactivated by SacP (EII^Scr) (according to Swiss-Prot)

Structure

• 1TLV (the PRD domains of LicT, corresponds to aa 54 ... 271, 41% identity) PubMed

Expression and Regulation

Operons

• Genes: sacT
  Description: PubMed

  Regulatory mechanism

  • DnaA: repression, PubMed, in DnaA regulon

  Regulation

  • repressed by casamino acids PubMed

• Genes: ywcI-sacT
  Description: PubMed

  Regulatory mechanism

  • DnaA: repression, PubMed, in DnaA regulon

  Regulation

  • repressed by casamino acids PubMed

  Additional information

  • the mRNA is substantially stabilized upon depletion of RNase Y PubMed

Biological materials

Mutant

• GP429 (spc), available in Jörg Stülke's lab
• BKE38070 (sacT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
• BKK38070 (sacT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG

Expression vectors

• for expression, purification of both PRDs in E. coli with N-terminal His-tag, in pWH844: pGP166, available in Jörg Stülke's lab
• for expression, purification of PRD-1 in E. coli with N-terminal His-tag, in pWH844: pGP426, available in Jörg Stülke's lab
• for expression, purification of PRD-2 in E. coli with N-terminal His-tag, in pWH844: pGP427, available in Jörg Stülke's lab
• for expression, purification of PRD-1 in E. coli with N-terminal His-tag and thrombin cleavage site, in pGP570: pGP439, available in Jörg Stülke's lab
• for expression, purification of PRD-2 in E. coli with N-terminal His-tag and thrombin cleavage site, in pGP570: pGP440, available in Jörg Stülke's lab
• for expression, purification of RNA-binding domain in E. coli with N-terminal His-tag and thrombin cleavage site, in pGP570: pGP571, available in Jörg Stülke's lab
• for expression of RNA-binding domain in B. subtilis, in pBQ200: pGP446, available in Jörg Stülke's lab
• for expression, purification of sacT-full length in B. subtilis with C-terminal Strep-tag, in pGP382: pGP1064, available in Jörg Stülke's lab
• for expression, purification of sacT-full length in B. subtilis with N-terminal Strep-tag, in pGP380: pGP1068, available in Jörg Stülke's lab

GFP fusion

• GP1227 (spc, based on pGP1870), available in Jörg Stülke's lab

FLAG-tag construct

• GP1223 (spc, based on pGP1331), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading