You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ptkA [2019-02-19 19:22:30]
Molecular weight
25.64 kDa
Function
protein phosphorylation
Product
protein tyrosine kinase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,731,822 3,732,535
Phenotypes of a mutant
Accumulation of extra chromosome equivalents PubMedDefect in biofilm formation, this involves the kinase activity, but the target protein is unknown PubMed The protein
Catalyzed reaction/ biological activity
ATP + a [protein]-L-tyrosine = ADP + a [protein]-L-tyrosine phosphate (according to Swiss-Prot), autophosphorylation, phosphorylation of Ugd, TuaD, SsbB, SsbB Protein family
Paralogous protein(s)
Domains
single BY-kinase domainModification
autophosphorylation at residues Y225, Y227 and Y228 (primary site) PubMed, dephosphorylated by PtpZ PubMed Cofactors
ATPEffectors of protein activity
TkmA - transmembrane modulator, activates PtkA autophosphorylation and substrate phosphorylation PubMedthe mutually exclusive interactions of PtsA with the modulator proteins TkmA, SalA, and probably MinD direct the kinase to different substrates PubMed Structure
2VED (CapB, the homolog in Staphylococcus aureus) Expression and Regulation
Biological materials
Mutant
MGNA-A078 (ywqD::erm), available at the NBRP B. subtilis, JapanKO strain created with pMUTIN-2, available from Ivan MijakovicGP1520 (spc), available in Jrg Stlke's labGP1544 (ermC), available in Jrg Stlke's labGP1587 (cat) , available in Jrg Stlke's labGP1521 epsB (aphA3) ptkA (spc) double mutant available in Jrg Stlke's labGP1529 tkmA-ptkA::spc available in Jrg Stlke's labGP1610 (ptkA-ptpZ, spc), available in Jrg Stlke's labBKE36250 (ptkA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCCBKK36250 (ptkA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCC Expression vectors
LacZ fusion
GFP fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading