rodZ [2020-04-05 12:59:45]

required for proper septum positioning during vegetative growth (cell shape determination), part of the Rod complex for lateral cell wall synthesis and control of cell diameter

Locus: BSU_16910

Isoelectric point: 4.68

Molecular weight: 23.48 kDa

Protein length: 288 aa

Gene length: 867 bp

Function: septum positioning during vegetative growth

Product: morphogenic protein

Essential: yes

Synonyms: ymfM

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell shape
• Lifestyles → Sporulation → Sporulation/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,761,707 1,762,573

Phenotypes of a mutant

• essential PubMed
• depletion results in the formation of shorter and rounder cells PubMed
• depletion results in disturbed formation of asymmetric septa and perturbed SigF activation PubMed
• hypersensitivity to sorbic acid stress PubMed
• small, round, DNA-containing cells PubMed

The protein

Domains

• N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) PubMed

Localization

• membrane protein (according to UniProt)

Additional information

• overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) PubMed
• RodZ is destabilized in a mreB mutant PubMed

Expression and Regulation

Operons

• Genes: ymfK/1-ymfK/2-rodZ
  Description: PubMed

Biological materials

Mutant

• MGNA-B120 (ymfM::erm), available at the NBRP B. subtilis, Japan
• BKE16910 (rodZ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
• BKK16910 (rodZ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC

Labs working on this gene/protein

• Adriano Henriques, Lisbon, Portugal homepage

References

Loading