You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yrkF [2019-07-08 08:29:01]
putative sulfur carrier protein
Molecular weight
20.51 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,712,577 2,713,134
The protein
Protein family
sulfur carrier protein TusA family (according to Swiss-Prot) (with YrkI) Structure
1DCJ (E. coli TusA, corresponds to the N-terminal domain of YrkF, aa 8 ... 77, 37% identity)3R2U (metallo--lactamase from Staphylococcus aureus, corresponds to the C-terminal domain of YrkF, aa 106 ... 179, 38% identity) Expression and Regulation
Biological materials
Mutant
BKE26530 (yrkF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTTTCCTCCTTTTCTT, downstream forward: _UP4_TAAATAAAAAGCATGATGAABKK26530 (yrkF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTTTCCTCCTTTTCTT, downstream forward: _UP4_TAAATAAAAAGCATGATGAA