You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ypsA [2020-07-24 09:39:38]
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
2,332,153 2,332,782
Phenotypes of a mutant
increased susceptibility to hydrogen peroxide treatment [pubmed|31024470]overexpression of YpsA interferes with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] assembly [pubmed|31024470]The protein
Protein family
SLOG superfamily of nucleotide and ligand-binding proteins [pubmed|31024470]UPF0398 family (single member, according to UniProt)Structure
[PDB|2NX2][SW|Localization]
cytoplasm (according to Swiss-Prot)Biological materials
Mutant
MGNA-A417 (ypsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/417 NBRP B. subtilis, Japan]BKE22190 ([gene|5E5894ABD87B095191B109CEA9CEA89A5CA8A82D|ypsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCACCTGCTTTAA, downstream forward: _UP4_TAACAATGAGAGAGAAATTTBKK22190 ([gene|5E5894ABD87B095191B109CEA9CEA89A5CA8A82D|ypsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCACCTGCTTTAA, downstream forward: _UP4_TAACAATGAGAGAGAAATTTReferences