epsE [2017-10-24 18:06:39]

inhibitor of motility and glycosyltransferase required for EPS biosynthesis

Locus: BSU34330

Isoelectric point: 9.80

Molecular weight: 32.05 kDa

Protein length: 278 aa

Gene length: 834 bp

Function: biofilm formation

Product: glycosyltransferase, inhibitor of motility

Essential: no

Synonyms: yveO

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Additional chemotaxis signal transduction and regulatory proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Matrix polysaccharide synthesis
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a Tyr residue

Gene

Coordinates: 3,524,417 → 3,525,253

Phenotypes of a mutant

• smooth colonies on MsGG medium, no biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• arrests flagellar rotation in a manner similar to that of a clutch, by disengaging motor force-generating elements in cells embedded in the biofilm matrix, separates the cytoplasmic FliG motor from the MotA-MotB stator PubMed
• biosynthesis of extracellular polysaccharides PubMed

Protein family

• glycosyltransferase 2 family (according to Swiss-Prot)

Modification

• phosphorylated by EpsB on a Tyr residue PubMed

Localization

• cell membrane, forms spots at flagellar basal bodies PubMed

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RemA: activation, PubMed, in RemA regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in SinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Regulation

  • repressed by SinR PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed
  • expression is increased in rsiX mutants PubMed

Biological materials

Mutant

• MGNA-B613 (yveO::erm), available at the NBRP B. subtilis, Japan
• BKE34330 (ΔepsE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
• BKK34330 (ΔepsE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA

Labs working on this gene/protein

• Daniel Kearns, Indiana University, Bloomington, USA, homepage
• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading

=The EAR RNA switch=

Loading