gbsR [2017-11-24 14:45:25]

transcription repressor of the gbsA-gbsB operon

locus: BSU31070

pI: 4.62

mw: 20.92 kDa

protein length: 180 aa

gene length: 540 bp

function: regulation of osmoprotection

product: transcription repressor

essential: no

synonyms: yuaC

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.4|Biosynthesis of glycine betaine]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]

Gene

Coordinates: 3,186,763 → 3,187,305

The protein

Catalyzed reaction/ biological activity

• sensing of choline and arsenocholine [Pubmed|29159878,22408163]
• control of the ''[gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]'' and ''[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]'' operons [Pubmed|22408163]

Effectors of protein activity

• binds the inducer choline with an apparent K(D) of approximately 165 μM [Pubmed|22408163]

Expression and Regulation

Operons

• genes: [gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]
  description: [Pubmed|22383849]

  regulation

  • upregulated in response to salt stress [Pubmed|32849357]

Biological materials

Mutant

• MGNA-A219 (yuaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/219 NBRP B. subtilis, Japan]
• BKE31070 (Δ[gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
• BKK31070 (Δ[gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG

Labs working on this gene/protein

• [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

References

• 22408163,28256787,29159878